Sequence ID | >WENV170015799 |
Genome ID | AZII01010155 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 286 |
End posion on genome | 362 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gaagccgcag |
tRNA gene sequence |
GCACCCATAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCGTAGGTTCGAA |
Downstream region at tRNA end position |
ccatttcatg |
Secondary structure (Cloverleaf model) | >WENV170015799 Arg CCG g ACCA ccatttcatg G - C C - G A - T C - G C - G C - G A - T T A T C A T C C A C G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |