Sequence ID | >WENV170015804 |
Genome ID | AZII01010418 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 9889 |
End posion on genome | 9814 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
caacgggcat |
tRNA gene sequence |
GCCGGGATAGCTCAGTCGGTAGAGCAACTGATTCGTAATCAGTAGGTCCGCGGTTCGATT |
Downstream region at tRNA end position |
tttattctta |
Secondary structure (Cloverleaf model) | >WENV170015804 Thr CGT t ACCA tttattctta G - C C - G C - G G - C G - C G + T A - T T T T G C G C C A T G A A | | | | | G C C T C G C G C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |