Sequence ID | >WENV170015809 |
Genome ID | AZII01011089 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 146 |
End posion on genome | 70 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tggttttttt |
tRNA gene sequence |
GTCCCCGTAGCTCAGCTGGATAGAGCAGCCCCCTCCTAAGGGGCAGGTCGCAGGTTCGAC |
Downstream region at tRNA end position |
aaggttattt |
Secondary structure (Cloverleaf model) | >WENV170015809 Arg CCT t GCCA aaggttattt G - C T - A C - G C - G C - G C - G G - C T C T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTC G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |