Sequence ID | >WENV170015810 |
Genome ID | AZII01011409 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 116 |
End posion on genome | 34 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gccaccatta |
tRNA gene sequence |
GCTCAAGTGGCGGAATTGGTAGACGCGTCGGATTCAAAATCCGATTCTTAGGAGTGCGGG |
Downstream region at tRNA end position |
gtaaacctcg |
Secondary structure (Cloverleaf model) | >WENV170015810 Leu CAA a ACAA gtaaacctcg G + T C - G T - A C - G A - T A - T G - C T T T C G C C C A T A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C T A G G TTCTTAGGAGT T - A C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |