Sequence ID | >WENV170015811 |
Genome ID | AZII01011475 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 609 |
End posion on genome | 682 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aatatacaaa |
tRNA gene sequence |
GCGCTCGTAGCTCAGCTGGATAGAGTGTCGCCCTCCGAAGGCGAAGGTCGTGGGTTCGAC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170015811 Arg CCG a Gnnn nnnnnnnnnn G - C C - G G - C C - G T - A C - G G - C T C T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | + T T G G A G T A T A G AGGTC T - A C - G G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |