Sequence ID | >WENV170015814 |
Genome ID | AZII01011781 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 736 |
End posion on genome | 809 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cctgatcaat |
tRNA gene sequence |
TCCTCTGTAGCTCAGTTGGTAGAGCAAATGACTGTTAATCATTGGGTCACTGGTTCGAGT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170015814 Asn GTT t GCnn nnnnnnnnnn T - A C - G C - G T - A C - G T + G G - C T G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |