Sequence ID | >WENV170015817 |
Genome ID | AZII01012226 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 456 |
End posion on genome | 528 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cggtcattcc |
tRNA gene sequence |
CGTTTAGTAGCTCAATTGGTAGAGCTTTTGGCTGTTAACCAAAAGGTTATTGGTTCGAAT |
Downstream region at tRNA end position |
ttaatttaaa |
Secondary structure (Cloverleaf model) | >WENV170015817 Asn GTT c Tttt ttaatttaaa C C G A T - A T - A T - A A - T G - C T A T T A A C C A T A A A | | | | | G T C T C G A T T G G C G | | | | T T G G A G C T A T AGGTT T - A T - A T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |