Sequence ID | >WENV170015818 |
Genome ID | AZII01012466 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 858 |
End posion on genome | 934 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttcaaagtat |
tRNA gene sequence |
GGTCATGTAGCTCAGCTGGTTAGAGCACGGCATTCATAATGCCGGGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
tttcaagttt |
Secondary structure (Cloverleaf model) | >WENV170015818 Met CAT t ACCA tttcaagttt G - C G - C T - A C - G A - T T - A G - C T G T C C A C C A C G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A A GGGTC C - G G - C G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |