Sequence ID | >WENV170015821 |
Genome ID | AZIJ01000268 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 34 |
End posion on genome | 120 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcgatacagt |
tRNA gene sequence |
GCCAGCGTGGTGAAATTGGTAGACACAGGGGATTCAAAATCCCCCGCCTTAACGGGTGTG |
Downstream region at tRNA end position |
cttaaaagct |
Secondary structure (Cloverleaf model) | >WENV170015821 Leu CAA t ACCA cttaaaagct G + T C - G C - G A - T G - C C - G G - C T G T C G G C C A T A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G A CGCCTTAACGGGTGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |