Sequence ID | >WENV170015824 |
Genome ID | AZIJ01000323 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 583 |
End posion on genome | 508 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccgcgtggtc |
tRNA gene sequence |
GGGCCCTTAGCTCAGTTGGTAGAGCAACTGACTTTTAATCAGTAGGTCGCTGGTTCGAAC |
Downstream region at tRNA end position |
catttttcaa |
Secondary structure (Cloverleaf model) | >WENV170015824 Lys TTT c ACCA catttttcaa G - C G + T G - C C - G C - G C - G T - A C A T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |