Sequence ID | >WENV170015825 |
Genome ID | AZIJ01000329 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 501 |
End posion on genome | 577 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cgtgcgcgtt |
tRNA gene sequence |
GCACTCGTAGCTCAGCTGGATAGAGTACTGCCCTCCGAAGGCAGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tatcaagaaa |
Secondary structure (Cloverleaf model) | >WENV170015825 Arg CCG t GCCA tatcaagaaa G - C C - G A - T C - G T - A C - G G - C T A T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |