Sequence ID | >WENV170015826 |
Genome ID | AZIJ01000391 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2260 |
End posion on genome | 2334 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atgctaaaaa |
tRNA gene sequence |
GGTCCTATAACTCAGCTGGTTAGAGTATCTGACTCATAATCAGAAAGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
aattgaaaag |
Secondary structure (Cloverleaf model) | >WENV170015826 Met CAT a ACag aattgaaaag G - C G - C T - A C - G C - G T + G A - T C G T G G A C C A C G A A | | | | | G T C T C A C C T G G C G | | | | T T G G A G T T T A A AAGTC T - A C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |