Sequence ID | >WENV170015832 |
Genome ID | AZIJ01000596 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3800 |
End posion on genome | 3727 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
acgcggttat |
tRNA gene sequence |
AGAGGATTGGTGTAATGGTAGCATGACGGTCTCCAAAACCGTTCGTCAAGGTTCGAGTCC |
Downstream region at tRNA end position |
aataaatgaa |
Secondary structure (Cloverleaf model) | >WENV170015832 Trp CCA t GCCA aataaatgaa A - T G - C A - T G - C G - C A - T T - A T G T G T T C C A A A G | | | | | G T T G T G C A A G G C G + | | + T T G G C A T T A G TCGT A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |