Sequence ID | >WENV170015833 |
Genome ID | AZIJ01000677 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 716 |
End posion on genome | 801 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctcagcacgg |
tRNA gene sequence |
GCGAGGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCTTCGGACGTGG |
Downstream region at tRNA end position |
cactgagaaa |
Secondary structure (Cloverleaf model) | >WENV170015833 Leu CAG g ACCA cactgagaaa G - C C - G G - C A - T G + T G - C G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGTCCTTCGGACGT C - G T - A A - T G + T C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |