Sequence ID | >WENV170015836 |
Genome ID | AZIJ01000703 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 742 |
End posion on genome | 668 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aaaacaattt |
tRNA gene sequence |
GGGGGATTAGCTCAGTTGGCTAGAGCGCTACGCTGGCAGCGTAGAGGTCATCGGTTCGAA |
Downstream region at tRNA end position |
ataaaaagtc |
Secondary structure (Cloverleaf model) | >WENV170015836 Ala GGC t ACag ataaaaagtc G - C G - C G + T G - C G + T A - T T - A T A T T A G C C A T G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A A - T C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |