Sequence ID | >WENV170015837 |
Genome ID | AZIJ01000803 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 4552 |
End posion on genome | 4636 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
taaaaaaact |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGTAACGGAGCAGATTGCTAATCTGTCGACGGGCAACCGTCGCC |
Downstream region at tRNA end position |
tatagagttt |
Secondary structure (Cloverleaf model) | >WENV170015837 Ser GCT t GCat tatagagttt G - C G - C A - T G - C A - T G - C G + T T G T G T C C C A G A G | | | | | G T G G C C C A G G G C G | | | T T G A C G G T A A CGACGGGCAACCGTCGC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |