Sequence ID | >WENV170015840 |
Genome ID | AZIJ01000822 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 550 |
End posion on genome | 476 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
actattatcg |
tRNA gene sequence |
GGTCCCATAGCTCAGCTGGTTAGAGCACCTGACTCATAATCAGGGGGTCCATGGTTCGAG |
Downstream region at tRNA end position |
tttttcaaaa |
Secondary structure (Cloverleaf model) | >WENV170015840 Met CAT g ACtt tttttcaaaa G - C G - C T - A C - G C - G C - G A - T C G T G T A C C A C G A A | | | | | G T C T C G C A T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |