Sequence ID | >WENV170015848 |
Genome ID | AZIJ01001254 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3782 |
End posion on genome | 3872 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgccacttca |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTGAAGGAGCACGCCTGGAAAGTGTGTATACGCTAACCGCGT |
Downstream region at tRNA end position |
gatacaagag |
Secondary structure (Cloverleaf model) | >WENV170015848 Ser GGA a GCCA gatacaagag G - C G - C A - T G - C A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A T G A G TATACGCTAACCGCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |