Sequence ID | >WENV170015856 |
Genome ID | AZIJ01001831 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 647 |
End posion on genome | 561 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctcacccaat |
tRNA gene sequence |
GCAGATGTGGTGGAATTGGTAGACACGCTAGCTTCAGGTGCTAGTGCCTTCACGGGCGTG |
Downstream region at tRNA end position |
tcccgatcag |
Secondary structure (Cloverleaf model) | >WENV170015856 Leu CAG t ACCA tcccgatcag G - C C - G A - T G - C A - T T - A G - C T G T C C C T C A T A A G | | | | | G T G G T G G G G A G C G | | | T T G A C A C T A G G TGCCTTCACGGGCGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |