Sequence ID | >WENV170015858 |
Genome ID | AZIJ01001907 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2109 |
End posion on genome | 2035 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgcccaccgt |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAGCTGTTTTTGGTACAGTGTACCGTAGGTTCGAATC |
Downstream region at tRNA end position |
aatcccgttt |
Secondary structure (Cloverleaf model) | >WENV170015858 Gln TTG t GCCA aatcccgttt T - A G - C G - C G - C G - C T - A G - C T A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GTACC G + T C - G T - A G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |