Sequence ID | >WENV170015859 |
Genome ID | AZIJ01001928 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 493 |
End posion on genome | 418 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gagagacaag |
tRNA gene sequence |
GCCGGTATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCGGGGTTCGACT |
Downstream region at tRNA end position |
tctcggcgaa |
Secondary structure (Cloverleaf model) | >WENV170015859 Thr TGT g ACCA tctcggcgaa G - C C - G C - G G - C G - C T + G A - T T C T G C T C C A T G A A | | + | | G T C T C G C G G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |