Sequence ID | >WENV170015867 |
Genome ID | AZIJ01002434 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7623 |
End posion on genome | 7547 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
catcaaatac |
tRNA gene sequence |
GCGCTCATAGCTCAGCTGGATAGAGCACTTGGCTACGAACTAAGGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
atttgaagaa |
Secondary structure (Cloverleaf model) | >WENV170015867 Arg ACG c ACCA atttgaagaa G - C C - G G - C C - G T - A C - G A - T T A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C A T A A GGGTC C - G T - A T - A G + T G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |