Sequence ID | >WENV170015868 |
Genome ID | AZIJ01002435 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 437 |
End posion on genome | 348 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctcgtgttac |
tRNA gene sequence |
GGTGAGATGGGTGAGTGGCTGAAACCACATCCCTGCTAAGGATGCATACGGGTAACTGTA |
Downstream region at tRNA end position |
ctttacttaa |
Secondary structure (Cloverleaf model) | >WENV170015868 Ser GCT c GCCA ctttacttaa G - C G - C T - A G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CATACGGGTAACTGTATC C - G A - T T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |