Sequence ID | >WENV170015875 |
Genome ID | AZIJ01002592 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 789 |
End posion on genome | 865 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
agcacatttt |
tRNA gene sequence |
AGGACTATAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGGCGGTTCGAG |
Downstream region at tRNA end position |
gatttataaa |
Secondary structure (Cloverleaf model) | >WENV170015875 Val GAC t ACCA gatttataaa A - T G - C G - C A - T C - G T - A A - T T G T C C G C C A T G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |