Sequence ID | >WENV170015879 |
Genome ID | AZIJ01002696 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1367 |
End posion on genome | 1441 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ataaaaaact |
tRNA gene sequence |
GCGAAAGTAGCTCAGGGGTAGAGCATCACCTTGCCAAGGTGAGGGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
gacactgtta |
Secondary structure (Cloverleaf model) | >WENV170015879 Gly GCC t TCTA gacactgtta G - C C - G G - C A - T A - T A - T G - C T A T T G C C C A G A A + | | | | A G C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |