Sequence ID | >WENV170015883 |
Genome ID | AZIJ01002927 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 472 |
End posion on genome | 397 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcggtcgcgt |
tRNA gene sequence |
GCCCCATTAGCTCAGCTGGTAGAGCAGGTCCTTCGTAAGGACAAGGTCGGCGGTTCGAGT |
Downstream region at tRNA end position |
ctttcctcct |
Secondary structure (Cloverleaf model) | >WENV170015883 Thr CGT t ACCA ctttcctcct G - C C - G C - G C - G C - G A - T T - A T G T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A AGGTC G A G - C T - A C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |