Sequence ID | >WENV170015885 |
Genome ID | AZIJ01002967 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 358 |
End posion on genome | 444 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gccgcctcgt |
tRNA gene sequence |
GCCTCGATGGCGGAATCGGTAGACGCAGCGGATTCAAAATCCGCCGCTGGCGACAGCGTG |
Downstream region at tRNA end position |
tcagattcat |
Secondary structure (Cloverleaf model) | >WENV170015885 Leu CAA t ACCA tcagattcat G - C C - G C - G T + G C - G G - C A - T T G T C T C T C A T A A G | | | | | G C G G C G G A G A G C G | | | T T G A C G C T A G A CGCTGGCGACAGCGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |