Sequence ID | >WENV170015887 |
Genome ID | AZIJ01003041 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 322 |
End posion on genome | 246 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttgagataaa |
tRNA gene sequence |
CGGGGTATAGCGCAGCCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGAGAGTTCGAA |
Downstream region at tRNA end position |
gtttttttga |
Secondary structure (Cloverleaf model) | >WENV170015887 Pro TGG a ACCA gtttttttga C - G G - C G - C G - C G - C T - A A - T T A T C T C C C A C G A A | | | | G C C G C G G A G A G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |