Sequence ID | >WENV170015895 |
Genome ID | AZIJ01003353 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 374 |
End posion on genome | 300 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aggagacgac |
tRNA gene sequence |
AGGGGTATCGCCAAGCGGTAAGGCACTGGATTCTGATTCCAGCATGCGGAGGTTCGAATC |
Downstream region at tRNA end position |
aacaccatga |
Secondary structure (Cloverleaf model) | >WENV170015895 Gln CTG c GCCA aacaccatga A - T G - C G - C G - C G - C T - A A - T T A T C C T C C A G A C | | | | | G C A C C G G G A G G C G | | | T T G A G G C T A A CATGC C - G T - A G - C G - C A - T T T T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |