Sequence ID | >WENV170015916 |
Genome ID | AZIJ01004165 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1103 |
End posion on genome | 1027 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gctggttcaa |
tRNA gene sequence |
GGCCCCGTGGCTCAACTGGATAGAGCAGCCCCCTCCTAAGGGGCAGGTTGTTGGTTCGAA |
Downstream region at tRNA end position |
aaaccgcctg |
Secondary structure (Cloverleaf model) | >WENV170015916 Arg CCT a ACCA aaaccgcctg G - C G + T C - G C - G C - G C - G G - C T A T C A A C C A C A A G | | | | | G T C T C G G T T G G C G | | | | T T G G A G C A T A A AGGTT G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |