Sequence ID | >WENV170015932 |
Genome ID | AZIJ01004622 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 5795 |
End posion on genome | 5871 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cgacgtattt |
tRNA gene sequence |
GCGCTTGTAGCTCAGCTGGATAGAGCAACCGCCTCCTAAGCGGTAGGTCCCCGGTTCGAA |
Downstream region at tRNA end position |
tcttcctttc |
Secondary structure (Cloverleaf model) | >WENV170015932 Arg CCT t ACCA tcttcctttc G - C C - G G - C C - G T C T T G - C T A T G G G C C A C G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |