Sequence ID | >WENV170015934 |
Genome ID | AZIJ01004679 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 404 |
End posion on genome | 329 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gtgagtttac |
tRNA gene sequence |
GTCCCATTCGTCTAGTGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAAC |
Downstream region at tRNA end position |
ttctcttgca |
Secondary structure (Cloverleaf model) | >WENV170015934 Glu TTC c GCCA ttctcttgca G - C T - A C - G C - G C - G A - T T - A C A T T C C C C A T G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |