Sequence ID | >WENV170015936 |
Genome ID | AZIJ01004690 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 6271 |
End posion on genome | 6198 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tctcaataat |
tRNA gene sequence |
GGTGCCTTAGCTCAGTTGGTAGAGCAACGGACTGAAAATCCGTGTGTCCCTAGTTCGATT |
Downstream region at tRNA end position |
ttaatccccg |
Secondary structure (Cloverleaf model) | >WENV170015936 Phe GAA t ACat ttaatccccg G - C G - C T - A G - C C - G C - G T - A T T T G G T T C A T G A A | | | | G T C T C G C C T A G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |