Sequence ID | >WENV170015939 |
Genome ID | AZIJ01004768 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1703 |
End posion on genome | 1788 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agcgcgcaaa |
tRNA gene sequence |
GCCCCGATGGTGAAATTGGTAGACACAAGGGATTTAAAATCCCTCGGCCTTTGGCTGTAC |
Downstream region at tRNA end position |
gtcagtctgt |
Secondary structure (Cloverleaf model) | >WENV170015939 Leu TAA a ACCA gtcagtctgt G - C C - G C - G C - G C - G G - C A - T T G T T G G C C A T A A G | | | | | G T A G T G A C C G G C G | | | T T G A C A C T A G A CGGCCTTTGGCTGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |