Sequence ID | >WENV170015942 |
Genome ID | AZIJ01004925 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2003 |
End posion on genome | 2095 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
cggctcttga |
tRNA gene sequence |
GGGGGTGTAGCTCAGAGGTAGAGCGGTGGCCTTATAAGCCATGAGCGCCAGATTAGCGCA |
Downstream region at tRNA end position |
gcccgggccc |
Secondary structure (Cloverleaf model) | >WENV170015942 Ile TAT a ACCA gcccgggccc G + T G - C G - C G - C G - C T + G G - C T A T C G G C C A G A A | | | | | G A C T C G G C C G G C G | | | | T T G G A G C T A G GAGCGCCAGATTAGCGCACGGTC G + T T - A G - C G - C C - G C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |