Sequence ID | >WENV170015949 |
Genome ID | AZIJ01005383 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 747 |
End posion on genome | 663 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgcccagcct |
tRNA gene sequence |
GCCCGTGTGGCGGAATTGGTAGACGCAGGGGATTCAAAATCCCCCGCCTAACGGCTTGCC |
Downstream region at tRNA end position |
caggctgctt |
Secondary structure (Cloverleaf model) | >WENV170015949 Leu CAA t ACCA caggctgctt G + T C - G C - G C - G G - C T - A G - C T G T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G A CGCCTAACGGCTT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |