Sequence ID | >WENV170015953 |
Genome ID | AZIJ01005450 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 5296 |
End posion on genome | 5221 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgcccacttt |
tRNA gene sequence |
GGCGCGATAGCTCAGTCGGTAGAGCAACGGATTGAAAATCCGTGTGTCCCCAGTTCGATC |
Downstream region at tRNA end position |
tagatttgta |
Secondary structure (Cloverleaf model) | >WENV170015953 Phe GAA t ACCA tagatttgta G - C G - C C - G G - C C A G - C A - T C T T G G G T C A T G A A | | | | | G C C T C G C C C A G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |