Sequence ID | >WENV170015955 |
Genome ID | AZIJ01005457 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1149 |
End posion on genome | 1239 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccgtgttgc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCCGAAGGCGCTCCCCTGCTAAGGGAGTACACCTCAAAAGGGT |
Downstream region at tRNA end position |
tattgcatga |
Secondary structure (Cloverleaf model) | >WENV170015955 Ser GCT c GCCA tattgcatga G - C G - C A - T G - C A - T G + T G - C T A T C C C C C A T G A G | | | | | G G G C C G G G G G G C G | | | T T C A G G C C G A G TACACCTCAAAAGGGTGTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |