Sequence ID | >WENV170015958 |
Genome ID | AZIJ01005459 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 555 |
End posion on genome | 631 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gcgcccccga |
tRNA gene sequence |
GTCCCAGTAGCTCAATTGGATAGAGCATCCCCCTCCTAAGGGGAAGGTTGTGAGTTCGAA |
Downstream region at tRNA end position |
cttgtttctc |
Secondary structure (Cloverleaf model) | >WENV170015958 Arg CCT a GCCA cttgtttctc G - C T - A C - G C - G C - G A - T G - C C A T C G C T C A T A A A | + | | | G T C T C G G T G A G C G | | | | T T G G A G C A T A A AGGTT T - A C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |