Sequence ID | >WENV170015959 |
Genome ID | AZIJ01005499 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 4024 |
End posion on genome | 4113 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agccgccatt |
tRNA gene sequence |
GGAAGCGTGGCAGAGCGGTTTAATGCACCGGTCTTGAAAACCGACGAGGGTGTGAGTCCT |
Downstream region at tRNA end position |
aatacttaaa |
Secondary structure (Cloverleaf model) | >WENV170015959 Ser TGA t GCCA aatacttaaa G - C G - C A - T A - T G - C C - G G - C T A T C A C T C A C G A G | | | | | G G G A C G G T G A G C G | | | T T T A T G C T T A A CGAGGGTGTGAGTCCTCC C A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |