Sequence ID | >WENV170015965 |
Genome ID | AZIJ01005761 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 5727 |
End posion on genome | 5653 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gttacacgtt |
tRNA gene sequence |
AGGGGCGTCGCCAAGTGGTAAGGCACCGGGTTTTGATCTCGGCATCCGTTGGTTCGAATC |
Downstream region at tRNA end position |
attttcacct |
Secondary structure (Cloverleaf model) | >WENV170015965 Gln TTG t GCCA attttcacct A - T G - C G - C G - C G - C C - G G - C T A T C G A C C A G A C | + | | | G T A C C G G T T G G C G | | | T T G A G G C T A A CATCC C - G C - G G - C G + T G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |