Sequence ID | >WENV170015972 |
Genome ID | AZIJ01006013 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1180 |
End posion on genome | 1104 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaagaaatat |
tRNA gene sequence |
AGTCTCGTAGCTCAGCTGGTTAGAGTACTACACTGATAATGTAGGGGTCGGCAGTTCGAG |
Downstream region at tRNA end position |
aaactcttct |
Secondary structure (Cloverleaf model) | >WENV170015972 Ile GAT t ACTA aaactcttct A - T G - C T - A C - G T + G C - G G - C T G T C C G T C A C G A A | | | | | G T C T C G G G C A G C G | | | + T T G G A G T T T A A GGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |