Sequence ID | >WENV170015974 |
Genome ID | AZIJ01006029 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7574 |
End posion on genome | 7665 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ataagaccgc |
tRNA gene sequence |
GGAGAGATGGCAGAGTTCGGTTGAATGCACCTGACTTGAAATCAGGCGTGGGCTCGCGCC |
Downstream region at tRNA end position |
ctattcccaa |
Secondary structure (Cloverleaf model) | >WENV170015974 Ser TGA c GCCA ctattcccaa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T T G A G | + | | | G C G A C G G G G G G C G | | | T T G A T G C T T G A A CGTGGGCTCGCGCCCACC C - G C - G T - A G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |