Sequence ID | >WENV170015976 |
Genome ID | AZIJ01006029 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 12102 |
End posion on genome | 12175 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caatttcaat |
tRNA gene sequence |
GGCGGGTTGGCAGAATGGCTATGCAGCGGATTGCAAATCCGTGGATCTCGGTTCGACTCC |
Downstream region at tRNA end position |
ttgaagaaga |
Secondary structure (Cloverleaf model) | >WENV170015976 Cys GCA t TCCA ttgaagaaga G - C G - C C - G G - C G - C G - C T - A T C T G G G C C A A A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A GGAT G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |