Sequence ID | >WENV170015977 |
Genome ID | AZIJ01006029 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 12204 |
End posion on genome | 12290 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tttacagaat |
tRNA gene sequence |
GCCCGGGTGGTGAAATTGGTAGACACAAGGGATTTAAAATCCCTCGCTGGTAACAGCGTG |
Downstream region at tRNA end position |
ttctttttga |
Secondary structure (Cloverleaf model) | >WENV170015977 Leu TAA t ACCA ttctttttga G - C C - G C - G C - G G - C G - C G - C T G T C G G C C A T A A G | | | | | A T A G T G G C C G G C G | | | T T G A C A C T A G A CGCTGGTAACAGCGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |