| Sequence ID | >WENV170015978 |
| Genome ID | AZIJ01006029 |
| Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
| Species | |
| Start position on genome | 47488 |
| End posion on genome | 47412 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
cagcatcgga |
| tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAA |
| Downstream region at tRNA end position |
atcctttcga |
| Secondary structure (Cloverleaf model) | >WENV170015978 Met CAT
a ACCA atcctttcga
C A
G - C
C - G
G - C
G - C
G - C
G - C T A
T C G T C C A
T G A G | + | | | A
C C G A G G T A G G C
T | | | | T T
G G C T C
G T A G AGGTC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |