Sequence ID | >WENV170015980 |
Genome ID | AZIJ01006064 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 194 |
End posion on genome | 118 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
catgtatcat |
tRNA gene sequence |
GGCGAGGTAGCTCAGATGGTTAGAGCGTCGGATTCATAACCCGGAGGTCTCGGGTTCAAT |
Downstream region at tRNA end position |
acaacaaaac |
Secondary structure (Cloverleaf model) | >WENV170015980 Met CAT t ACAA acaacaaaac G + T G - C C - G G - C A - T G - C G + T T T T A G C C C A A G A A | | | | | A T C T C G T C G G G C G | | | | T T G G A G C T T A G AGGTC T + G C - G G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |