| Sequence ID | >WENV170015983 |
| Genome ID | AZIJ01006085 |
| Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
| Species | |
| Start position on genome | 1001 |
| End posion on genome | 1076 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
ttatgaagtg |
| tRNA gene sequence |
GTGGCTGTAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTTGTCGTGGGTTCAAGT |
| Downstream region at tRNA end position |
tttctctgct |
| Secondary structure (Cloverleaf model) | >WENV170015983 His GTG
g CCCA tttctctgct
G - C
T - A
G - C
G - C
C - G
T - A
G - C T G
T T A C C C A
T G A A + | | | | A
T C T C G G T G G G C
G | | | | T T
G G A G C
T A C TTGTC
C - G
C - G
G - C
G - C
A - T
T T
T A
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |