Sequence ID | >WENV170015983 |
Genome ID | AZIJ01006085 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1001 |
End posion on genome | 1076 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ttatgaagtg |
tRNA gene sequence |
GTGGCTGTAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTTGTCGTGGGTTCAAGT |
Downstream region at tRNA end position |
tttctctgct |
Secondary structure (Cloverleaf model) | >WENV170015983 His GTG g CCCA tttctctgct G - C T - A G - C G - C C - G T - A G - C T G T T A C C C A T G A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C T A C TTGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |