Sequence ID | >WENV170015984 |
Genome ID | AZIJ01006085 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1116 |
End posion on genome | 1192 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
attctgaagt |
tRNA gene sequence |
CGGCGAGTAGCGCAGCTTGGTAGCGCACTTGTTTTGGGTACAAGGGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
ttctcttctc |
Secondary structure (Cloverleaf model) | >WENV170015984 Pro TGG t ACCA ttctcttctc C - G G - C G - C C - G G - C A - T G - C T A T T G A C C A C G A A + | | | | G T C G C G G C T G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |