Sequence ID | >WENV170015991 |
Genome ID | AZIJ01006434 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 141 |
End posion on genome | 216 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tactcgctca |
tRNA gene sequence |
GGGCGCTTAGCTCAGTTGGTAGAGCGTCTGCCTTACAAGCAGAATGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
tatcttatct |
Secondary structure (Cloverleaf model) | >WENV170015991 Val TAC a ACCA tatcttatct G - C G - C G - C C - G G - C C - G T - A C T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |